Week 6-Delayed

Unfortunately, my progress on Escherichia coli DNA extraction was slightly delayed today, as I utilized a dead strain for this week's culture, thereby ensuring that the incubation period was for naught. However, I successfully re-grew another culture from another strain, and was able to devote the additional incubation time to completion of background research into DNA extraction protocols. I was also able to edit and submit my research abstract to the Estrella Mountain Student Conference selection committee.

A basic E. coli informational video:

The abstract is here, should one be curious as to my research goal(s):

Identification and Application of Universal 16s rRNA Ribsomal Primers to Known Bacterial Species

Since the complete genetic sequencing of the Escherichia coli genome in 1997 (Blattner, et.al), variations of the 16s ribosomal gene have been found conserved among different bacterial species. As a result, 16s ribosomal DNA sequencing has become an integral part of bacterial identification in the modern laboratory (Janda & Abbot, 2007). The initial step of the identification process requires extraction of DNA, which must then be amplified using a polymerase chain reaction (PCR) so it can be sequenced. Primers specific to certain regions of the 16s gene are utilized to replicate the bacterial DNA during the PCR process so that the resultant DNA can be sequenced and correctly identified (Mao et. al 2012). Primers currently in widespread use by laboratories are targeted at specific individual bacterial species; however, certain primers utilized in this study have been demonstrated to have the ability to be applied universally to known bacteria (Frank, et. al, 2008, & Marchesi, et. al, 1998). This study will identify universal 16s ribosomal primers that can be used to identify four common laboratory bacteria used by the Biology Department of Phoenix College. These bacterial species are Escherichia coli, Pseudomonas aeruginosa, Staphylococcus aureus, and Streptococcus pyogenes. Primers 8F (AGAGTTTGATCCTGGCTCAG), 27F (AGAGTTTGATCMTGGCTCAG), 1492R (GGTTACCTTGTTACGACTT), and 1492R² (ACCTTGTTACGACTT) will be analyzed to determine feasibility of application to the four known bacterium included above. Primers potentially identified as universal will then be adapted into a student lab protocol to accompany the standard clinical format of culturing both known and unknown bacteria and thereby introduce the student learner to elementary DNA identification technology.

References: Blattner, R., Plunkett III, G., Bloch, C., Perna, N., Burland, V., Riley, M., Collado-Vides, J., & Glasner, J. (1997). The complete genome sequence of escherichia coli k-12. Science, 277, 1453-1462. doi: 10.1126/science.277.5331.1453. Frank, J., Reich, C., Sharma, S., Weisbaum, J., Wilson, B., & Olsen, G. (2008). Critical evaluation of two primers commonly used for amplification of bacterial 16s rRNA genes. 74(8), 2461-2470. Janda, J., & Abbot, S. (2007). 16s rRNA gene sequencing for bacterial identification in the diagnostic laboratory: Pluses, perils, and pitfalls. Journal of Clinical Microbiology, 45(9), 2761-2764. Mao, D., Zhou, Q., Chen, C., & Quan, Z. (2012). Coverage evaluation of universal bacterial primers using the metagenomic datasets. BMC Microbiology, 12(66), Retrieved from www.biomedcentral.com/1471-2180/12/66. Marchesi, J., Soto, T., Weightman, A., Martin, T., Fry, J., Hiom, S., & Wade, W. (1997). Design and evaluation of useful bacterium-specific PCR primers that amplify genes coding for bacterial 16s rRNA. Applied and Environmental Microbiology, 64(2), 795-799.