Translate
Tuesday, March 25, 2014
Week 9-Finally.
Testing of multiple DNA extraction processes has begun.
I started this week by growing my own batch of E. coli from lab stock, so that I can simply create a fresh batch when needed. Successful extractions apparently hinge on the age of the E. coli culture, with extractions performed during the first 24 hours of incubation most usable for this project. So each day this week begins with culturing new stock for the following day's lab.
I am testing a variety of protocols. The simplest method is as follows:
E. coli broth was centrifuged @13,200x g for 15 min. The supernatant was eliminated, and the remaining pellet was re-suspended in molecular biology-grade water and centrifuged @13,200 g for 10 min. The supernatant was again eliminated, with the pellet re-suspended in m g-b water and boiled at 100°C for 10 min. The sample was then cooled on ice for 10 minutes. The supernatant was then removed and stored overnight @ -20°C.
Other methods include digestion by protein, simple boiling, and cold ethanol additions. More on these methods to follow as the project progresses.
By the way, the DNA pics are not mine. I found them on a simple Google search and I thought that they are rad so I shared them.
Thursday, March 20, 2014
Week 8: Post-Spring Break
This week was utilized to learn the protocols I will be using for DNA extractions. These will be performed next week. I have not been making the progress I had hoped for at successfully extracting e. Coli DNA, for multiple reasons including the age of the base culture being used (my cultures were outside the optimal extraction period of 24-hours from inception.) Therefore, I asked for and received additional guidance from the lab department r.e. my methodology; now with that assistance, I am on schedule to rapidly increase the pace of my research. By this time next week, I should be proficient at multiple extraction techniques.
Some of the techniques I will be using include simple boiling, cold ethanol addition, centrifuging with enzymatic digestion, and even a simple mixture of common household detergent and cold ethanol. The specificities of each method are written in the protocols for each test and will be included in the write-up of post-testing results. The protocols resulting in successful extraction will also be posted on this blog for perusal.
Please enjoy the following animation:
http://youtu.be/TfYf_rPWUdY
Some of the techniques I will be using include simple boiling, cold ethanol addition, centrifuging with enzymatic digestion, and even a simple mixture of common household detergent and cold ethanol. The specificities of each method are written in the protocols for each test and will be included in the write-up of post-testing results. The protocols resulting in successful extraction will also be posted on this blog for perusal.
Please enjoy the following animation:
Tuesday, March 4, 2014
Week 6-Delayed
Unfortunately, my progress on Escherichia coli DNA extraction was slightly delayed today, as I utilized a dead strain for this week's culture, thereby ensuring that the incubation period was for naught. However, I successfully re-grew another culture from another strain, and was able to devote the additional incubation time to completion of background research into DNA extraction protocols. I was also able to edit and submit my research abstract to the Estrella Mountain Student Conference selection committee.
A basic E. coli informational video:
The abstract is here, should one be curious as to my research goal(s):
Identification and Application of Universal 16s rRNA Ribsomal Primers to Known Bacterial Species
A basic E. coli informational video:
The abstract is here, should one be curious as to my research goal(s):
Identification and Application of Universal 16s rRNA Ribsomal Primers to Known Bacterial Species
Since the complete genetic sequencing of
the Escherichia coli genome in 1997
(Blattner, et.al), variations of the 16s ribosomal gene have been found
conserved among different bacterial species. As a result, 16s ribosomal DNA
sequencing has become an integral part of bacterial identification in the
modern laboratory (Janda & Abbot, 2007). The initial step of the identification
process requires extraction of DNA, which must then be amplified using a
polymerase chain reaction (PCR) so it can be sequenced. Primers specific to
certain regions of the 16s gene are utilized to replicate the bacterial DNA
during the PCR process so that the resultant DNA can be sequenced and correctly
identified (Mao et. al 2012). Primers currently in widespread use by
laboratories are targeted at specific individual bacterial species; however,
certain primers utilized in this study have been demonstrated to have the
ability to be applied universally to known bacteria (Frank, et. al, 2008, &
Marchesi, et. al, 1998). This study will identify universal 16s ribosomal
primers that can be used to identify four common laboratory bacteria used by
the Biology Department of Phoenix College. These bacterial species are Escherichia coli, Pseudomonas aeruginosa,
Staphylococcus aureus, and Streptococcus
pyogenes. Primers 8F (AGAGTTTGATCCTGGCTCAG),
27F (AGAGTTTGATCMTGGCTCAG), 1492R (GGTTACCTTGTTACGACTT), and 1492R2 (ACCTTGTTACGACTT) will be
analyzed to determine feasibility of application to the four known bacterium
included above. Primers potentially identified as universal will then be
adapted into a student lab protocol to accompany the standard clinical format
of culturing both known and unknown bacteria and thereby introduce the student
learner to elementary DNA identification technology.
References: Blattner, R., Plunkett III, G.,
Bloch, C., Perna, N., Burland, V., Riley, M., Collado-Vides, J., & Glasner,
J. (1997). The complete genome sequence of escherichia coli k-12. Science,
277, 1453-1462. doi: 10.1126/science.277.5331.1453. Frank, J., Reich, C., Sharma,
S., Weisbaum, J., Wilson, B., & Olsen, G. (2008). Critical evaluation of
two primers commonly used for amplification of bacterial 16s rRNA genes. 74(8),
2461-2470.
Janda, J.,
& Abbot, S. (2007). 16s rRNA gene sequencing for bacterial identification
in the diagnostic laboratory: Pluses, perils, and pitfalls. Journal of
Clinical Microbiology, 45(9), 2761-2764. Mao, D., Zhou, Q., Chen, C.,
& Quan, Z. (2012). Coverage evaluation of universal bacterial primers using
the metagenomic datasets. BMC Microbiology, 12(66), Retrieved
from www.biomedcentral.com/1471-2180/12/66. Marchesi,
J., Soto, T., Weightman, A., Martin, T., Fry, J., Hiom, S., & Wade, W.
(1997). Design and evaluation of useful bacterium-specific PCR primers that
amplify genes coding for bacterial 16s rRNA. Applied and Environmental
Microbiology, 64(2), 795-799.
Subscribe to:
Posts (Atom)

.png)