Hello! This final week of the semester has been consumed by data collection and its requisite formatting into both the required research paper and oral presentation, but I did manage to find time in the lab to complete one last experiment. As mentioned in previous Semester 2 blogs, the primary focus this term has been on perfecting extraction protocols and electrophoresis gel production techniques. This focus was rewarded by repeated successful DNA extractions from the initial bacteria, E. coli, and the project was also extended to included two additional gram-negative species, P. aeruginosa and P. vulgaris, as well as one gram-positive organism, S. aureus.
As a final test before the next phase of my project, I took my successfully extracted samples and ran a PCR on them using my existing primers. I then tested the resultant samples for DNA using the gel technique I developed this semester. The result? Negative for DNA. However, this is not discouraging news. In fact, the results simply confirmed my suspicion that the primers I selected based on my original review of results published in Critical Evaluation of Two Primers Commonly Used
for Amplification of Bacterial 16s rRNA Genes (Frank, et. al., 2008) would not work for the species in this study. This leads me directly to the next step of this project, designing my own primers, which will resume in January, 2015. Until then, cheers!
A scanning electron micrograph image of Pseudomonas aeruginosa cultured onboard shuttle mission STS-115, courtesy www.nasa.gov .
Translate
Wednesday, December 3, 2014
Friday, November 21, 2014
Week 13, Semester 2-Success!
This week my DNA research project yielded new results, which upon discovery nearly had me leaping into the air from excitement. However, I refrained from doing so lest I give lie to the calm and studious façade I have cultivated this semester, and instead allowed myself only a silent "Hallelujah" and a brief victory trot through the lab to share my results with any available listeners.
A slight change in electrophoresis gel creation methodology yielded the clearest DNA banding I have yet received during this project. I have tested different gel recipes to-date, with varying results, and recently I began testing the optimal conditions for adding the DNA stain SybrGreen directly to my uncongealed gel solution before pouring and setting the gels. Previously, I simply added the DNA stain into each well as I added the DNA sample for testing; however, these gels showed limited or zero presence of DNA banding. To test the hypothesis that a direct addition would result in improved gel performance, I conducted a comparison experiment of the two gel types. I prepared four DNA samples using an identical protocol. I then created two gels from the same buffer/agarose base. I poured one gel, added DNA stain directly to the remaining mixture, then poured the second and allowed both to set. Finally, I loaded the samples. After thirty-five minutes running @200 volts, gel one showed zero DNA present, yet gel two showed clear banding. While this result was expected, it was exciting nonetheless.
Gel protocol:
The gels utilized for this test were created using a 0.9 g agarose/100 mL buffer mixture heated for 1:45 minutes on high in the microwave. Immediately after heating, gel #1 was poured. The remaining 75 mL mixture was allowed to cool to exactly 60°C, and then 3µl of 10,000x concentration SybrGreen was added and diffused into solution using a five-second swirling action. Gel #2 was poured, then both gels were allowed to set for 20 minutes in darkness (to prevent degradation of the SybrGreen due to UV light). The buffer mixture contained 980 mL/20mL de-ionized water/50X TAE buffer stock.
I was also able to expand the project to include additional bacterial species, which was another turn towards progress as my original hypothesis theorized the existence of universal primers that can be applied to multiple bacterial species. To-date, all experiments have utilized only E. coli. With this experiment, Pseudomonas aeruginosa, Proteus vulgaris, and Staphylococcus aureus were also subjected to extraction and gel testing. All four species yielded positive results after electrophoresis, with the gram-positive S. aureus providing the most limited results. These were the results I both projected would occur and hoped for. After some additional testing to replicate this week's results with the added bacterial species, this project should now be able to move forward to the next phase, which is intended to focus on primer design.
Altogether, it was a successful week. Please enjoy this photo of my gel results until the next blog. Cheers!
A slight change in electrophoresis gel creation methodology yielded the clearest DNA banding I have yet received during this project. I have tested different gel recipes to-date, with varying results, and recently I began testing the optimal conditions for adding the DNA stain SybrGreen directly to my uncongealed gel solution before pouring and setting the gels. Previously, I simply added the DNA stain into each well as I added the DNA sample for testing; however, these gels showed limited or zero presence of DNA banding. To test the hypothesis that a direct addition would result in improved gel performance, I conducted a comparison experiment of the two gel types. I prepared four DNA samples using an identical protocol. I then created two gels from the same buffer/agarose base. I poured one gel, added DNA stain directly to the remaining mixture, then poured the second and allowed both to set. Finally, I loaded the samples. After thirty-five minutes running @200 volts, gel one showed zero DNA present, yet gel two showed clear banding. While this result was expected, it was exciting nonetheless.
Gel protocol:
The gels utilized for this test were created using a 0.9 g agarose/100 mL buffer mixture heated for 1:45 minutes on high in the microwave. Immediately after heating, gel #1 was poured. The remaining 75 mL mixture was allowed to cool to exactly 60°C, and then 3µl of 10,000x concentration SybrGreen was added and diffused into solution using a five-second swirling action. Gel #2 was poured, then both gels were allowed to set for 20 minutes in darkness (to prevent degradation of the SybrGreen due to UV light). The buffer mixture contained 980 mL/20mL de-ionized water/50X TAE buffer stock.
I was also able to expand the project to include additional bacterial species, which was another turn towards progress as my original hypothesis theorized the existence of universal primers that can be applied to multiple bacterial species. To-date, all experiments have utilized only E. coli. With this experiment, Pseudomonas aeruginosa, Proteus vulgaris, and Staphylococcus aureus were also subjected to extraction and gel testing. All four species yielded positive results after electrophoresis, with the gram-positive S. aureus providing the most limited results. These were the results I both projected would occur and hoped for. After some additional testing to replicate this week's results with the added bacterial species, this project should now be able to move forward to the next phase, which is intended to focus on primer design.
Altogether, it was a successful week. Please enjoy this photo of my gel results until the next blog. Cheers!
Left to right: E. coli, P. aeruginosa, P. vulgaris, S. aureus
Thursday, November 20, 2014
Week 12, Semester 2
This week is focused on expanding my extraction protocols to include additional bacterial species. To date, E. coli has been the sole species utilized for all extractions and polymerase chain reactions(PCRs). The additional species that have been included are : Pseudomonas aeruginosa, Proteus vulgaris, and Staphylococcus aureus. The two former were chosen due both to availability and their status as gram-negative bacteria; the protocol I am using for extractions was specifically developed for application against gram-negative species, due to the structural differences that exist between gram-negative and gram-positive species. S. aureus, though gram-positive, was selected both to test to efficacy of the gram-negative protocol against a positive species and to be used as the base species for design of a gram-positive specific protocol. It is expected that my current protocol will be ineffective at producing DNA from a gram-positive organism due to the gram-negative specificity of the cell lysing agents used in the developed protocol, thus a separate protocol will have to be designed.
Until the next blog, please enjoy the following links.
Everything you always wanted to know about unlocking and sequencing the human genome can be found at this fascinating Smithsonian website:
http://www.genome.gov/smithsonian/
Gain access to my personal favorite scientific study, the Gombe Research Project, which Dr. Jane Goodall has been conducting for more than 50 years; use Google Earth to enjoy the panoramic views of chimpanzee individuals, their family groups, and the Tanzanian park within which they reside.
http://www.google.com/maps/about/behind-the-scenes/streetview/treks/gombe-tanzania/
Photo credit: Fanni, photographed by Anup Shah for National Geographic Magazine.
Access additional photos and background information at:
http://ngm.nationalgeographic.com/ngm/0304/feature4/zoom4.html
Until the next blog, please enjoy the following links.
Everything you always wanted to know about unlocking and sequencing the human genome can be found at this fascinating Smithsonian website:
http://www.genome.gov/smithsonian/
Gain access to my personal favorite scientific study, the Gombe Research Project, which Dr. Jane Goodall has been conducting for more than 50 years; use Google Earth to enjoy the panoramic views of chimpanzee individuals, their family groups, and the Tanzanian park within which they reside.
http://www.google.com/maps/about/behind-the-scenes/streetview/treks/gombe-tanzania/
Photo credit: Fanni, photographed by Anup Shah for National Geographic Magazine.
Access additional photos and background information at:
http://ngm.nationalgeographic.com/ngm/0304/feature4/zoom4.html
Thursday, November 13, 2014
Week 11, Semester 2-A Much-Needed Break
Hello! Last week, I was able to join our fellow scholars and faculty advisors for a welcome bit of rest and relaxation on our first field trip of the semester. We piled into the van and headed for Dreamy Draw Park and Recreation Area to hunt for an (alleged) alien crash site, do a little hiking and geo-caching, and eat lunch courtesy of Phoenix College. Who knew exercise and getting a sunburn could be so fun?
Even though the nearest Starbucks drive-through was miles away, somehow we managed to have a great time, use GPS, and learn about ephemeral desert washes before the day was over. No alien life forms were spotted, but somehow it didn't matter when I looked around at the smiling faces of this semester's team of scholars and faculty and realized once again how lucky I am to be part of this crew. It saddens me to think that another semester has almost come and gone, and before long this program, for me, will have concluded.
Next week I will pick up my research again, and begin drafting this semester's research paper. Until then, please enjoy these candid pics from our outing.
Even though the nearest Starbucks drive-through was miles away, somehow we managed to have a great time, use GPS, and learn about ephemeral desert washes before the day was over. No alien life forms were spotted, but somehow it didn't matter when I looked around at the smiling faces of this semester's team of scholars and faculty and realized once again how lucky I am to be part of this crew. It saddens me to think that another semester has almost come and gone, and before long this program, for me, will have concluded.
Next week I will pick up my research again, and begin drafting this semester's research paper. Until then, please enjoy these candid pics from our outing.
Thursday, November 6, 2014
Week 10, Semester 2
Hello! And welcome back to this blog.
This week has been focused on reviewing the data collected thus far and determining the next steps of my research project. I have decided to analyze genomic sequences of the various bacteria named in my abstract for sequence correlations; this will allow me to predict a primer design that will result in DNA amplification during the polymerase-chain reaction (PCR) process. This design prediction is in line with my original project hypothesis, which is that there are universal primers for PCR usage which will successfully amplify DNA from seven common bacterial species (all species are named in my abstract; see blog Week 6, Semester 1 for details.)
After primer design is complete, the next phase of this project is to repeat the procedures used to conduct extractions on E. coli. The entire protocol testing process will not be repeated; only the protocol and precipitate solutions found to be successful at extracting E. coli will be used on the six remaining species. Then, bacterial samples from all seven species will be submitted for PCR amplification using the specific primers that were designed.
This next phase begins in earnest in Week 11. For my remaining lab time this week, I will be joining the Biology staff and other S-STEM scholars on a much-needed off-site field trip to the Dreamy Draw Park & Recreation Area. For those of you who are unable to attend, please enjoy this shot of our beautiful desert, taken from within the park.
This week has been focused on reviewing the data collected thus far and determining the next steps of my research project. I have decided to analyze genomic sequences of the various bacteria named in my abstract for sequence correlations; this will allow me to predict a primer design that will result in DNA amplification during the polymerase-chain reaction (PCR) process. This design prediction is in line with my original project hypothesis, which is that there are universal primers for PCR usage which will successfully amplify DNA from seven common bacterial species (all species are named in my abstract; see blog Week 6, Semester 1 for details.)
After primer design is complete, the next phase of this project is to repeat the procedures used to conduct extractions on E. coli. The entire protocol testing process will not be repeated; only the protocol and precipitate solutions found to be successful at extracting E. coli will be used on the six remaining species. Then, bacterial samples from all seven species will be submitted for PCR amplification using the specific primers that were designed.
This next phase begins in earnest in Week 11. For my remaining lab time this week, I will be joining the Biology staff and other S-STEM scholars on a much-needed off-site field trip to the Dreamy Draw Park & Recreation Area. For those of you who are unable to attend, please enjoy this shot of our beautiful desert, taken from within the park.
Thursday, October 30, 2014
Week 9, Semester 2.
Colorized low-temperature electron micrograph, E. coli. https://www.flickr.com/photos/microbeworld/5981923914/
Welcome back to this blog!
This week's focus consists of running a polymerase-chain reaction (PCR) on the DNA samples previously discussed in the Week 5, Semester 2 edition of this blog. It remains to be seen if the primers utilized were successful at the DNA amplification process, for as of publication time the PCR was still in progress; thus the results had not been analyzed.
The next phase of this project will proceed beginning next week with the extension of the extraction protocol to other bacterial species endemic to this lab. The methodology utilized for E. coli extractions and testing will be repeated with each additional species; every phase of the project from extraction, to electrophoresis gel, to spectrometer reading, to finally PCR will be repeated with each additional species to identify any correlations or errors in the methodology used and results obtained.
After the multi-species extractions have been finished, the project will conclude for the semester with an analysis of the genomic sequences specific to each bacterial species. The primers selected for the initial E. coli PCR's were referenced as being universal in the work Critical Evaluation of Two Primers Commonly Used for Amplification of Bacterial 16S rRNA Genes (Frank, et. al, 2008) and were therefore selected for further testing. However, it is hypothesized that further examination of the individual genomes is warranted to determine if a new primer design is needed for application to species other than E. coli.
Further details to follow on the next blog issue.
Thursday, October 23, 2014
Week 8, Semester 2. Success!
Hello! And welcome back to my blog.
This week, I resumed testing of samples previously extracted from E. coli bacterium. Both protocols submitted for analysis utilized a 0.3 ml TBS and 10 µl SDS solution to lyse the cells, a 55°C heating and ice cooling method combined with a protein precipitation solution to reduce protein contamination and an isopropanol/ethanol wash to precipitate chromosomal DNA and clean the DNA pellet.The protocols differed in the substances used for protein precipitation; protocol one (P1) utilized proteinase K, and protocol two (P2) utilized a guanadine hydrochloride/sodium acetate solution. They also differed in length of precipitation in isopropanol; P1 was in solution for five minutes while P2 remained in solution @ -20°C for five days.
The samples were placed in an electrophoresis gel for analysis. The gels were created @ a ratio of 20 g agarose/100 ml 1 X TAE buffer ratio, with 4 µl of 10,000x concentration SYBY green DNA stain added to solution post-heating.
The spectrometer was also used to measure ultraviolet absorbance ratios of the four samples. Samples were subjected to 260 nm, 280 nm, and 320 nm consecutively.
Results:
DNA!
All four samples showed banding in the gel; P1 sample two contained the most clearly visible banding. The photo that follows is of the samples. The clarity is a bit off due to the age of the camera used to capture the image.
Calculations from the spectrometer readings to follow on my next blog. Happy learning!
DNA!
All four samples showed banding in the gel; P1 sample two contained the most clearly visible banding. The photo that follows is of the samples. The clarity is a bit off due to the age of the camera used to capture the image.
Calculations from the spectrometer readings to follow on my next blog. Happy learning!
Thursday, October 16, 2014
Week 7-Semester 2.Mathopolis
Hello! Lab work is progressing, albeit at a slower pace than I would prefer. However, previous efforts to accelerate the pace of my project have shown that a consistent, repeated, and measured approach is most conducive to accurate results. Whether double- and triple-checking all calculations before beginning a protocol, or repeatedly verifying the settings on a pipette as I work, I have found that adhering to an established technique is the key to both finding and repeating accurate results.
Luckily for me, I have been inundated by the structured world of math this semester. I am taking Chemistry, Physics, and Trigonometry concurrently, so I spend quite a bit of time weekly honing my mathematical skills. This focus has transferred over to my research here in the lab and increased my proficiency at performing the calculations needed to move forward with my project.
This week has been heavily focused on gaining and retaining math skills, but I did focus on extractions as well. I was also able to finally utilize the recipe for the protein precipitation solution provided by Cori Leonetti, our in-house microbiologist. Unfortunately, due to a scheduling conflict with some classes, I was unable to access all the equipment needed to complete my protocols until late in the week. Therefore, the results of this week's work remain to be seen; until the process has been completed, here is the solution I am using to precipitate proteins from my DNA samples.
4.2 M Guanidinium Hydrochloride
0.9 M Sodium Acetate
4.8 pH target
De-ionized water to reach total volume of 50 mL
I calculated the molarity of the solution targeting a final volume of 50 mL. The GuHCl was in an 8.0 M solution; the sodium acetate was in solid form, so I used a mole-mass conversion to calculate the amount needed. I then mixed, observed for solubility, and added de-ionized water until nearly at final volume. I then measured the pH. The result was approximately 6.3, so I added HCL by dropper until the pH was reduced until it reached the desired result. I then added the remaining de-ionized water to achieve full volume and re-measured the pH for a final result.
More on the usage of this solution and further extractions to follow. Until then, please enjoy the following:
Luckily for me, I have been inundated by the structured world of math this semester. I am taking Chemistry, Physics, and Trigonometry concurrently, so I spend quite a bit of time weekly honing my mathematical skills. This focus has transferred over to my research here in the lab and increased my proficiency at performing the calculations needed to move forward with my project.
This week has been heavily focused on gaining and retaining math skills, but I did focus on extractions as well. I was also able to finally utilize the recipe for the protein precipitation solution provided by Cori Leonetti, our in-house microbiologist. Unfortunately, due to a scheduling conflict with some classes, I was unable to access all the equipment needed to complete my protocols until late in the week. Therefore, the results of this week's work remain to be seen; until the process has been completed, here is the solution I am using to precipitate proteins from my DNA samples.
4.2 M Guanidinium Hydrochloride
0.9 M Sodium Acetate
4.8 pH target
De-ionized water to reach total volume of 50 mL
I calculated the molarity of the solution targeting a final volume of 50 mL. The GuHCl was in an 8.0 M solution; the sodium acetate was in solid form, so I used a mole-mass conversion to calculate the amount needed. I then mixed, observed for solubility, and added de-ionized water until nearly at final volume. I then measured the pH. The result was approximately 6.3, so I added HCL by dropper until the pH was reduced until it reached the desired result. I then added the remaining de-ionized water to achieve full volume and re-measured the pH for a final result.
More on the usage of this solution and further extractions to follow. Until then, please enjoy the following:
Thursday, October 9, 2014
Week 6-Semester 2. Reference Guide #1
Hello! This week again finds that my DNA extractions
and subsequent absorbance readings conducted using the spectrophotometer will
fall on Friday, the day after this blog is due. As a result, any data
collection and methodology conducted this week will appear in a later blog
post.
Part of my research project this semester is to become
personally proficient in the use of all lab equipment and also guide any
students that follow in the operation of the previously mentioned (on this
blog) “lost” spectrophotometer by compiling detailed instructions for usage. Therefore,
this week’s post will be a brief process analysis about using the Helios spectrophotometer to take live UV
absorbance ratio readings.
The reader should be cautioned that there are additional
methods for taking readings, such as programming and saving fixed methods, and
other nuances within the settings menu that may affect sequence progression of
individual wells and absorbance ratio levels. This additional information will
be included in future blog posts. In the interim, I have pre-set and saved the
settings needed to conduct the following protocol. If implemented as described,
without any changes to the settings menu, the user can quickly and easily take
accurate live absorbance readings.
Quick guide to live reads:
Notes/overview:
·
The Helios
needs 10-15 minutes to warm up before being used.
·
The user should not leave the lid open
or peer into the bay for an extended length of time; safety goggles with UV protection
are recommended.
·
Bacterial DNA solutions should be at a
1µl DNA/99µl diluting liquid ratio (total volume 100µl). Molecular
biology-grade water works best due to its purity.
·
The control sample should be 100 µl of the
same liquid used to dilute the DNA sample.
·
Due to an inherent flaw in the design of
the Helios, both control and DNA
samples may need to be increased to 200µl total volume each to improve data
collection.
·
One reading will be taken of the control
sample @ 260 nm to set a baseline.
·
Each DNA sample will be subjected to
three nm readings in the following order: 260 (to measure DNA presence), 280
(to measure protein contamination), and 320 (to measure turbidity, i.e.
additional contaminants). It is important to begin with the 260 nm setting, as any
DNA will be degraded by the higher wavelengths, and accurate measurements will
be negatively affected by using a different progression sequence.
·
The user should record absorbance ratios
given by each nm level in order to later calculate DNA purity and concentration.
Begin:
1) Insert
control cuvette into well #1. Place cuvettes containing DNA samples in wells 2-7 as needed.
2) Make
sure well #1 is aligned in anterior position (between UV bulbs).
3) Program
control sample:
a) Set
UV nm @ 260 nm for zero-base reading by pressing “nm” on LED display.
b) Type
desired nm wavelength (260) in display. Hit enter.
c) Press
zero-base key to set read at zero.
d) LED
display should read 0.000 A 260 nm. Record data by writing it down (or print by
pressing print key on LED display.)
4) Program
DNA samples:
a) Use
right arrow key to advance to desired well.
b) Set
initial read @ 260 nm as outlined in step 3.
c) Display
will show absorbance reading @ 260 nm. Record data.
d) Re-set
nm @ 280 nm. Record data.
e) Re-set
nm @ 320. Record data.
f) Repeat
steps 4a-e for additional wells.
The procedure is as simple as that! Good luck with
your samples!
Please enjoy this excellent website from the Smithsonian about DNA. Website is also photo credit:
http://www.genome.gov/smithsonian/
Tuesday, September 30, 2014
Week 5, Semester 2. 10/01 Success!
Hello!
Last week, after learning the nuances of the lab spectrophotometer, I was able to run my previous week's extractions through the spec and get some readings. According to the data collected, I was successful at extracting DNA. This is excellent news, as far the progression of my research is concerned.
I was quite surprised by the differences in the amount of DNA successfully collected and what materials provided those results. The methodology utilized in both of my extractions was identical, only varying in the type and amount of protein precipitation solution I used to clean up the sample. I used an expensive proteinase K dilution ($40/ 5 mg vial, diluted @ 5 mg/250 µL) for protocol number one and an inexpensive (99 cents, diluted at 0.05 g/µL), commercially available meat tenderizer dilution for protocol number two. I had expected the proteinase K solution to realize the best results, yet instead it was the cheaper solution that produced the most DNA. Protocol number one only showed a DNA concentration of 15 µg/mL, while the cheaper protocol number two yielded 1535 µg/mL. This was a substantial difference that only reminded me that, to date in my research, the simpler methods are often the most useful.
I am still searching for a DNA sample of known concentration that we have in-stock, so that I can dilute it and take a spec reading on it. Since the concentration will already be known, I can use it as a control to verify that the measurements I am taking on the spec are in fact correct. More on that to follow as this project progresses.
Until next week, cheers! And enjoy this Ted talk from one of the Nobel Laureates who discovered the structure of DNA, Dr. James Watson.
http://video.ted.com/talk/podcast/2005/None/JamesWatson_2005-480p.mp4
Last week, after learning the nuances of the lab spectrophotometer, I was able to run my previous week's extractions through the spec and get some readings. According to the data collected, I was successful at extracting DNA. This is excellent news, as far the progression of my research is concerned.
I was quite surprised by the differences in the amount of DNA successfully collected and what materials provided those results. The methodology utilized in both of my extractions was identical, only varying in the type and amount of protein precipitation solution I used to clean up the sample. I used an expensive proteinase K dilution ($40/ 5 mg vial, diluted @ 5 mg/250 µL) for protocol number one and an inexpensive (99 cents, diluted at 0.05 g/µL), commercially available meat tenderizer dilution for protocol number two. I had expected the proteinase K solution to realize the best results, yet instead it was the cheaper solution that produced the most DNA. Protocol number one only showed a DNA concentration of 15 µg/mL, while the cheaper protocol number two yielded 1535 µg/mL. This was a substantial difference that only reminded me that, to date in my research, the simpler methods are often the most useful.
I am still searching for a DNA sample of known concentration that we have in-stock, so that I can dilute it and take a spec reading on it. Since the concentration will already be known, I can use it as a control to verify that the measurements I am taking on the spec are in fact correct. More on that to follow as this project progresses.
Until next week, cheers! And enjoy this Ted talk from one of the Nobel Laureates who discovered the structure of DNA, Dr. James Watson.
http://video.ted.com/talk/podcast/2005/None/JamesWatson_2005-480p.mp4
Thursday, September 25, 2014
Week 4, Semester 2. The Spectrophotometer
Greetings! This week's lab time has been devoted to perusing instruction manuals and searching online for information about the Helios spectrophotometer located in the lab. This is an excellent device that can be used to measure the ultraviolet light absorbance ratios of DNA extraction samples. The machine is a high tech and more accurate version of electrophoresis gels; both methods can tell the operator if there is actually DNA present in the sample measured.
In a nutshell, the spectrophotometer operates as follows: One loads the sample, and then takes measurements using different wavelengths of ultraviolet light. A wavelength of 260 nm will indicate the presence of DNA, a wavelength of 280 nm will indicate protein contamination, and a wavelength of 320 nm is used to measure the turbidity of the sample, i.e. other possible contaminants. From these measurements, the operator can then use mathematical formulas to calculate the DNA purity and DNA concentration of the sample. This allows the operator to determine if his extraction protocols have been successful at removing DNA from his source material.
The Helios spec that we have in the lab was originally purchased more than a decade ago, and subsequently the knowledge needed to operate it has been lost. Therefore, I've spent most of my time this week educating myself as to the nuances of this particular brand. It's been a bit of a search, as the model was discontinued in 2011, and online technical support is no longer available. We still have the instruction manual, but it has little more information in it other than programming. Nothing is available in the manual about actually installing reading protocols. However, with a little diligence I have figured it out and am prepared to now use it to measure my samples.
Therefore, the remainder of my lab time this week will be spent extracting DNA from my E. coli cultures and then running them through the spectrophotometer to verify the protocol's success. More on that methodology and any successes or failures will follow on this blog next week. Until then, please enjoy the photo below of the machine that has taken all of my attention this week.
Cheers!
In a nutshell, the spectrophotometer operates as follows: One loads the sample, and then takes measurements using different wavelengths of ultraviolet light. A wavelength of 260 nm will indicate the presence of DNA, a wavelength of 280 nm will indicate protein contamination, and a wavelength of 320 nm is used to measure the turbidity of the sample, i.e. other possible contaminants. From these measurements, the operator can then use mathematical formulas to calculate the DNA purity and DNA concentration of the sample. This allows the operator to determine if his extraction protocols have been successful at removing DNA from his source material.
The Helios spec that we have in the lab was originally purchased more than a decade ago, and subsequently the knowledge needed to operate it has been lost. Therefore, I've spent most of my time this week educating myself as to the nuances of this particular brand. It's been a bit of a search, as the model was discontinued in 2011, and online technical support is no longer available. We still have the instruction manual, but it has little more information in it other than programming. Nothing is available in the manual about actually installing reading protocols. However, with a little diligence I have figured it out and am prepared to now use it to measure my samples.
Therefore, the remainder of my lab time this week will be spent extracting DNA from my E. coli cultures and then running them through the spectrophotometer to verify the protocol's success. More on that methodology and any successes or failures will follow on this blog next week. Until then, please enjoy the photo below of the machine that has taken all of my attention this week.
Cheers!
Thursday, September 18, 2014
Week 3, Semester 2. A New Path
Last week I prepped extraction samples from E. coli, using a simple extraction protocol provided by the lab's resident MicroBiology guru, Cori. Apparently, sometimes the simplest methodology is the best, as once the extractions were complete, I ran electrophoresis gels on the samples. The results under UV review indicated that DNA was successfully extracted. Hooray! (Or should I say, "Eureka! I've got it!") Exact details of methodology are available upon request, but as a general overview the protocol simply used TBS and SDS to lyse the sample cells, and room temperature isopropanol to precipitate the DNA. I then stored the samples @ -4°C for further testing this week.
This week's major breakthrough in my learning process occurred when I decided to figure out how to operate an old, unused photo-spectrometer that has been sitting in the lab for the better part of a decade. While discontinued from production, the unit isn't nearly as antiquated as one might think, and is decades newer than some of the other photo-specs I found stashed around the lab. It has a digital display for entering scanning protocols, and comes equipped with an internal printer to provide a hard copy of the test results.
In addition to learning the operations of this piece of equipment, I also refreshed my knowledge of UV wavelengths and the optimal range for UV scanning of DNA without sample degradation.
I did run some preliminary samples through the spec, but due to a calibration oversight the data was incorrect and will have to be repeated. Results on this to follow next week.
Here's an artist rendering of DNA. Enjoy!
Source: deviantart.com
This week's major breakthrough in my learning process occurred when I decided to figure out how to operate an old, unused photo-spectrometer that has been sitting in the lab for the better part of a decade. While discontinued from production, the unit isn't nearly as antiquated as one might think, and is decades newer than some of the other photo-specs I found stashed around the lab. It has a digital display for entering scanning protocols, and comes equipped with an internal printer to provide a hard copy of the test results.
In addition to learning the operations of this piece of equipment, I also refreshed my knowledge of UV wavelengths and the optimal range for UV scanning of DNA without sample degradation.
I did run some preliminary samples through the spec, but due to a calibration oversight the data was incorrect and will have to be repeated. Results on this to follow next week.
Here's an artist rendering of DNA. Enjoy!
Source: deviantart.com
Thursday, September 11, 2014
Week 2, Semester 2
Today I prepped for bacterial extractions, which begin in earnest tomorrow. To that end, I spent most of my time in the lab reviewing previous data results for potential improvements and/or changes to procedures, as well as taking inventory of the supplies I will need to complete the extractions. I also did mundane but necessary tasks, such as creating fresh buffers and gels for future electrophoreses.
I have identified two protocols that I have previously tested for further review. However, I will be changing the protein precipitates that I use to clean up the sample. A proteinase K solution and commercially available contact lens cleaner that I used in previous protocols provided promising results, so I will be testing them with the different protocols to determine if I can repeat or improve upon my previous data.
Due to the time needed to precipitate the DNA samples. I will be leaving them to incubate @ -4° C over the weekend. Hence, I will be unable to conduct a PCR to identify any successfully extracted, non-sheared DNA, until I am in the lab the following week.
Results will be posted on this blog at that time. In the interim, please enjoy this rendering of E. coli in glass, by the artist Luke Jerram.
http://www.lukejerram.com/glass/
I have identified two protocols that I have previously tested for further review. However, I will be changing the protein precipitates that I use to clean up the sample. A proteinase K solution and commercially available contact lens cleaner that I used in previous protocols provided promising results, so I will be testing them with the different protocols to determine if I can repeat or improve upon my previous data.
Due to the time needed to precipitate the DNA samples. I will be leaving them to incubate @ -4° C over the weekend. Hence, I will be unable to conduct a PCR to identify any successfully extracted, non-sheared DNA, until I am in the lab the following week.
Results will be posted on this blog at that time. In the interim, please enjoy this rendering of E. coli in glass, by the artist Luke Jerram.
http://www.lukejerram.com/glass/
Thursday, September 4, 2014
Week 1, Semester 2. Summer Recap
Hello! The last post on my blog left off as the S-STEM Scholars were getting ready to present their research results at the Estrella Mountain Student Conference. I am happy to update any incoming S-STEM Scholars with the following news: The Phoenix College Bio-Sciences Department swept the awards! Our students took all prizes in the visual presentation category. Kudos and congratulations to the prize winners. The accolades are well-deserved (and so were the prize monies that were distributed to the winners!)
Summer 2014 was utilized to continue variations of my spring research project. I continued to conduct DNA extractions on E. coli specimens, using multiple protocols and a variety of protein precipitates within each. Results were varied, with limited success. All samples were processed through electrophoresis gels and then viewed under UV light to determine banding, if any. Only two samples showed promise at this step, but when I progressed to polymerase-chain reactions (PCR) on those samples, the results changed from inconclusive to negative.
The semester was not fruitless, however. As I continued the processes of extractions, electrophoreses, and PCR's, my knowledge and expertise improved significantly. My fundamental understanding of DNA composition, lab equipment, mathematical calculations, the scientific method, and even my note-taking proficiency, were all improved by the extra fifty hours I was able to spend in the lab. Indubitably, this increase in knowledge will lead to positive results as I continue my project over the fall semester.
After a brief hiatus from my project that I have taken as summer became September, I am looking forward to resuming my work, re-connecting with old friends, and meeting the new scholars as we embark on another learning journey. See you in the lab!
P.S. For any math scholars out there: I would love to discuss summing integers and digital roots with you. I have been studying the phenomena of multiples of 9 whose integers sum back to 9; After multiple calculations and conferencing with Josh James, I became aware of the reduction patterns that accompany whole numbers from 1-8 after summing as well. This mathematical concept is absolutely intriguing me at this moment, and any light you can shed on the subject would be welcomed. Feel free to contact me!
credit: sapnaedu.in
Summer 2014 was utilized to continue variations of my spring research project. I continued to conduct DNA extractions on E. coli specimens, using multiple protocols and a variety of protein precipitates within each. Results were varied, with limited success. All samples were processed through electrophoresis gels and then viewed under UV light to determine banding, if any. Only two samples showed promise at this step, but when I progressed to polymerase-chain reactions (PCR) on those samples, the results changed from inconclusive to negative.
The semester was not fruitless, however. As I continued the processes of extractions, electrophoreses, and PCR's, my knowledge and expertise improved significantly. My fundamental understanding of DNA composition, lab equipment, mathematical calculations, the scientific method, and even my note-taking proficiency, were all improved by the extra fifty hours I was able to spend in the lab. Indubitably, this increase in knowledge will lead to positive results as I continue my project over the fall semester.
After a brief hiatus from my project that I have taken as summer became September, I am looking forward to resuming my work, re-connecting with old friends, and meeting the new scholars as we embark on another learning journey. See you in the lab!
P.S. For any math scholars out there: I would love to discuss summing integers and digital roots with you. I have been studying the phenomena of multiples of 9 whose integers sum back to 9; After multiple calculations and conferencing with Josh James, I became aware of the reduction patterns that accompany whole numbers from 1-8 after summing as well. This mathematical concept is absolutely intriguing me at this moment, and any light you can shed on the subject would be welcomed. Feel free to contact me!
credit: sapnaedu.in
Tuesday, April 29, 2014
Week 14-Research On Hold
Today is the final week of activities for this course, so any further research is on hold until the summer session begins. I have plans to repeat my methodology and protocols, double-checking calculations to see if I can determine what errors occurred that resulted in sheared DNA.
For the remainder of this week, I will be busy presenting at the Estrella Mountain conference, completing my research paper, and doing a brief oral presentation on my project for the other S-STEM scholars and Bio-Sciences department staff.
I was briefly disappointed, when I realized that my research to-date had been unsuccessful, but I very quickly got over it. I now view the project as incomplete, instead of failed, and will strive to complete it prior to the beginning of the fall semester. While I wait for a continuation, here is something for you to enjoy- My gels should have been horizontally banded like this image (minus the coloration), but were not:
Credit: www.helys-dna.com
For the remainder of this week, I will be busy presenting at the Estrella Mountain conference, completing my research paper, and doing a brief oral presentation on my project for the other S-STEM scholars and Bio-Sciences department staff.
I was briefly disappointed, when I realized that my research to-date had been unsuccessful, but I very quickly got over it. I now view the project as incomplete, instead of failed, and will strive to complete it prior to the beginning of the fall semester. While I wait for a continuation, here is something for you to enjoy- My gels should have been horizontally banded like this image (minus the coloration), but were not:
Credit: www.helys-dna.com
Thursday, April 24, 2014
Week 13- Elusive results
Last week, I was able to run another PCR and electrophoresis gel on my E. coli DNA samples. This time, I changed the primers that I paired to two that had melting temperatures with 4°C of each other, due to the prior PCR's annealing temperature being too low to generate results.
These are the primers that I used: 27F (AGAGTTTGATCMTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT). They had melting temperatures of 59.4°C and 55.8°C, respectively, so I ran the PCR with an annealing temperature of 54°C.
Unfortunately, while there was DNA present in my gel, it was sheared and did not successfully amplify. Here's a screen capture of the first gel from last week:
And here is the secondary image with the higher annealing temperature of 54°C:
As you can see, both gels are lacking the clearly define horizontal bands that indicate the presence of amplified DNA. So I will have to refine and repeat my methodology as I proceed. There is good news, however- I have been approved to return as an unpaid intern over the summer session. I will be able to continue my research. I am doing this for the sheer joy of the learning involved, and also so that I will hopefully be ahead in my project with the onset of the fall semester.
These are the primers that I used: 27F (AGAGTTTGATCMTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT). They had melting temperatures of 59.4°C and 55.8°C, respectively, so I ran the PCR with an annealing temperature of 54°C.
Unfortunately, while there was DNA present in my gel, it was sheared and did not successfully amplify. Here's a screen capture of the first gel from last week:
And here is the secondary image with the higher annealing temperature of 54°C:
As you can see, both gels are lacking the clearly define horizontal bands that indicate the presence of amplified DNA. So I will have to refine and repeat my methodology as I proceed. There is good news, however- I have been approved to return as an unpaid intern over the summer session. I will be able to continue my research. I am doing this for the sheer joy of the learning involved, and also so that I will hopefully be ahead in my project with the onset of the fall semester.
Tuesday, April 15, 2014
Week 12-Limited results
Today, I ran an electrophoresis gel on the six PCR samples that I created last week. Once again, I was reminded that a hurried project is a failed project, as I had to load three gels due to a calculation error in my sample sizes. The error occurred as a result of me attempting to rush through the loading process, instead of taking the time to check and then re-check my samples.
While the PCR process worked, it was not at optimal amplification and my gel was muddled. The likely culprit for this was probably the annealing temperature, which was set for all six samples at 43°C. The melting temperatures for my primers ranged from 48°C to 60°C. I had set the temperature to accommodate the lowest melting temperature of my four primers, in order to run all six samples through the thermal cycler during one PCR. Next week, I will repeat the PCR, but at that time I will run separate cycles depending on the primer samples, so that I can more closely align the annealing temperatures with the utilized primers.
Here is an image of the gel results:
While the PCR process worked, it was not at optimal amplification and my gel was muddled. The likely culprit for this was probably the annealing temperature, which was set for all six samples at 43°C. The melting temperatures for my primers ranged from 48°C to 60°C. I had set the temperature to accommodate the lowest melting temperature of my four primers, in order to run all six samples through the thermal cycler during one PCR. Next week, I will repeat the PCR, but at that time I will run separate cycles depending on the primer samples, so that I can more closely align the annealing temperatures with the utilized primers.
Here is an image of the gel results:
Thursday, April 10, 2014
Week 11- Turning up the heat
This week I began constructing the rough draft of my research paper. While incomplete, the formatting has been done and the paper is ready for insertion of data as the project progresses. Given the nature and pace of the project thus far, I anticipate final completion of the project to occur in the fall semester. That said, I have finished the initial phase of the project, which dealt with testing various DNA extraction protocols. I tested four protocols that utilized boiling, digestion, and cold ethanol. The simple boiling methods worked best not only at extraction, but were also preferable for ease of use. As one of the goals of my project is to develop a micro lab that will introduce the student learner to elementary DNA identification, it is important that I identify a protocol that is both simplified and time-efficient, so that the method will fit in the typical allotted class time.
This method was both easiest to use and successful at extracting Escherichia coli DNA:
Protocol 1: Autoclave 200
mL of de-ionized (DI) water on media cycle @ 121°C/15 PSI. Centrifuge 400µl of E. coli culture @ 10,000x g for 10
minutes to pellet the sample. Re-suspend pellet in 100µl of autoclaved DI
water. Incubate for 15 minutes @ 100°C in hot plate bath. Centrifuge sample @
10,000x g for 10 minutes. Remove supernatant and place into new Eppendorf tube. Store prepared sample @-20°C until ready to use.
This protocol had the added benefit of teaching the student sterile technique, due to the utilization not only of the autoclave, as in P1, but also the use of molecular-biology grade water:
Protocol 4: Autoclave
beaker on media cycle @121°C/15PSI to sterilize. Add 1ml of E. coli to 1.5 ml Eppendorf. Centrifuge
@13,200x g for 15 minutes. Eliminate supernatant, and re-suspend pellets in m-b
grade water. Centrifuge @13,200x g for 10 minutes. Eliminate supernatant, and
re-suspend pellets in 40µl of m-b- grade water. Boil @100°C for 10 minutes.
Cool on ice. Centrifuge @13,200x g for 10 seconds.
Today, I begin DNA amplification via the PCR process, so I will begin testing the universality of the primers I chose for this project. More on that next week. Cheers!
Here's a PCR machine in the old days, and a link to its origin and some useful information:
http://www.plantcellbiology.com/2012/03/you-dont-know-how-lucky-you-are-pcr-in-the-old-days/
Here's a PCR machine in the old days, and a link to its origin and some useful information:
http://www.plantcellbiology.com/2012/03/you-dont-know-how-lucky-you-are-pcr-in-the-old-days/
Thursday, April 3, 2014
Week 10
This week brought the news that my research project was accepted for presentation at the Estrella Mountain Student Conference; the S-STEM scholars, including myself, will also be presenting at Metrotech high school on April 25th. I look forward to the opportunity to hone my research for presentation to both groups. Truth be told, I am more interested in presenting to the vocational students than the other undergrads, as I look at it as an opportunity to potentially open a student's mind to the possibility of higher education.
My initial work in the lab this week was focused on completing an extraction protocol on the E. coli DNA that I have been using during this first phase of my project. Then I used a Promega Wizard DNA clean-up kit to remove contaminants from all four samples of DNA that I extracted last week. The cleanup protocol is as follows:
1. Re-suspend clean-up resin by inversion.
2. Add 1 mL of the re-suspended resin to a 1.5 mL micro centrifuge tube.
3. Add the sample to the clean-up resin and mix by inverting several times.
4. Attach a micro column to the barrel of a sterile 5 mL syringe.
5. Pipette the clean-up resin containing the bound DNA into the syringe barrel.
6. Slowly and gently push the slurry into the mini column with the syringe plunger.
7. Add 2 mL of 80% isopropanol to the syringe and gently push the solution through the mini column.
8. Transfer the mini column to an eppendorf tube and centrifuge for 2 minutes at 13200X g.
9. Transfer the mini column to a new eppendorf tube and apply 50 µl of 1x TE buffer and wait one minute.
10. Centrifuge the mini-column for thirty seconds at 13200x g.
11. Discard the mini column and keep the eppendorf tube containing the supernatant. The prepared sample can be stored at -20°.
I then prepared all four samples for an electrophoresis to identify if DNA was extracted. I used a 1x TAE solution to prepare both the buffer and the gel, then added 2 mL of each sample separate wells, followed by 1 mL each of loading dye and SYBR green. After adding the buffer, I initiated the ep process and covered it with a lab coat to reduce light interference. The gel ran from 24 minutes. The following is an image of the completed gel, with the two wells to the left consisting of control DNA provided by the lab coordinator, Josh.
My initial work in the lab this week was focused on completing an extraction protocol on the E. coli DNA that I have been using during this first phase of my project. Then I used a Promega Wizard DNA clean-up kit to remove contaminants from all four samples of DNA that I extracted last week. The cleanup protocol is as follows:
1. Re-suspend clean-up resin by inversion.
2. Add 1 mL of the re-suspended resin to a 1.5 mL micro centrifuge tube.
3. Add the sample to the clean-up resin and mix by inverting several times.
4. Attach a micro column to the barrel of a sterile 5 mL syringe.
5. Pipette the clean-up resin containing the bound DNA into the syringe barrel.
6. Slowly and gently push the slurry into the mini column with the syringe plunger.
7. Add 2 mL of 80% isopropanol to the syringe and gently push the solution through the mini column.
8. Transfer the mini column to an eppendorf tube and centrifuge for 2 minutes at 13200X g.
9. Transfer the mini column to a new eppendorf tube and apply 50 µl of 1x TE buffer and wait one minute.
10. Centrifuge the mini-column for thirty seconds at 13200x g.
11. Discard the mini column and keep the eppendorf tube containing the supernatant. The prepared sample can be stored at -20°.
I then prepared all four samples for an electrophoresis to identify if DNA was extracted. I used a 1x TAE solution to prepare both the buffer and the gel, then added 2 mL of each sample separate wells, followed by 1 mL each of loading dye and SYBR green. After adding the buffer, I initiated the ep process and covered it with a lab coat to reduce light interference. The gel ran from 24 minutes. The following is an image of the completed gel, with the two wells to the left consisting of control DNA provided by the lab coordinator, Josh.
Tuesday, March 25, 2014
Week 9-Finally.
Testing of multiple DNA extraction processes has begun.
I started this week by growing my own batch of E. coli from lab stock, so that I can simply create a fresh batch when needed. Successful extractions apparently hinge on the age of the E. coli culture, with extractions performed during the first 24 hours of incubation most usable for this project. So each day this week begins with culturing new stock for the following day's lab.
I am testing a variety of protocols. The simplest method is as follows:
E. coli broth was centrifuged @13,200x g for 15 min. The supernatant was eliminated, and the remaining pellet was re-suspended in molecular biology-grade water and centrifuged @13,200 g for 10 min. The supernatant was again eliminated, with the pellet re-suspended in m g-b water and boiled at 100°C for 10 min. The sample was then cooled on ice for 10 minutes. The supernatant was then removed and stored overnight @ -20°C.
Other methods include digestion by protein, simple boiling, and cold ethanol additions. More on these methods to follow as the project progresses.
By the way, the DNA pics are not mine. I found them on a simple Google search and I thought that they are rad so I shared them.
Thursday, March 20, 2014
Week 8: Post-Spring Break
This week was utilized to learn the protocols I will be using for DNA extractions. These will be performed next week. I have not been making the progress I had hoped for at successfully extracting e. Coli DNA, for multiple reasons including the age of the base culture being used (my cultures were outside the optimal extraction period of 24-hours from inception.) Therefore, I asked for and received additional guidance from the lab department r.e. my methodology; now with that assistance, I am on schedule to rapidly increase the pace of my research. By this time next week, I should be proficient at multiple extraction techniques.
Some of the techniques I will be using include simple boiling, cold ethanol addition, centrifuging with enzymatic digestion, and even a simple mixture of common household detergent and cold ethanol. The specificities of each method are written in the protocols for each test and will be included in the write-up of post-testing results. The protocols resulting in successful extraction will also be posted on this blog for perusal.
Please enjoy the following animation:
http://youtu.be/TfYf_rPWUdY
Some of the techniques I will be using include simple boiling, cold ethanol addition, centrifuging with enzymatic digestion, and even a simple mixture of common household detergent and cold ethanol. The specificities of each method are written in the protocols for each test and will be included in the write-up of post-testing results. The protocols resulting in successful extraction will also be posted on this blog for perusal.
Please enjoy the following animation:
Tuesday, March 4, 2014
Week 6-Delayed
Unfortunately, my progress on Escherichia coli DNA extraction was slightly delayed today, as I utilized a dead strain for this week's culture, thereby ensuring that the incubation period was for naught. However, I successfully re-grew another culture from another strain, and was able to devote the additional incubation time to completion of background research into DNA extraction protocols. I was also able to edit and submit my research abstract to the Estrella Mountain Student Conference selection committee.
A basic E. coli informational video:
The abstract is here, should one be curious as to my research goal(s):
Identification and Application of Universal 16s rRNA Ribsomal Primers to Known Bacterial Species
A basic E. coli informational video:
The abstract is here, should one be curious as to my research goal(s):
Identification and Application of Universal 16s rRNA Ribsomal Primers to Known Bacterial Species
Since the complete genetic sequencing of
the Escherichia coli genome in 1997
(Blattner, et.al), variations of the 16s ribosomal gene have been found
conserved among different bacterial species. As a result, 16s ribosomal DNA
sequencing has become an integral part of bacterial identification in the
modern laboratory (Janda & Abbot, 2007). The initial step of the identification
process requires extraction of DNA, which must then be amplified using a
polymerase chain reaction (PCR) so it can be sequenced. Primers specific to
certain regions of the 16s gene are utilized to replicate the bacterial DNA
during the PCR process so that the resultant DNA can be sequenced and correctly
identified (Mao et. al 2012). Primers currently in widespread use by
laboratories are targeted at specific individual bacterial species; however,
certain primers utilized in this study have been demonstrated to have the
ability to be applied universally to known bacteria (Frank, et. al, 2008, &
Marchesi, et. al, 1998). This study will identify universal 16s ribosomal
primers that can be used to identify four common laboratory bacteria used by
the Biology Department of Phoenix College. These bacterial species are Escherichia coli, Pseudomonas aeruginosa,
Staphylococcus aureus, and Streptococcus
pyogenes. Primers 8F (AGAGTTTGATCCTGGCTCAG),
27F (AGAGTTTGATCMTGGCTCAG), 1492R (GGTTACCTTGTTACGACTT), and 1492R2 (ACCTTGTTACGACTT) will be
analyzed to determine feasibility of application to the four known bacterium
included above. Primers potentially identified as universal will then be
adapted into a student lab protocol to accompany the standard clinical format
of culturing both known and unknown bacteria and thereby introduce the student
learner to elementary DNA identification technology.
References: Blattner, R., Plunkett III, G.,
Bloch, C., Perna, N., Burland, V., Riley, M., Collado-Vides, J., & Glasner,
J. (1997). The complete genome sequence of escherichia coli k-12. Science,
277, 1453-1462. doi: 10.1126/science.277.5331.1453. Frank, J., Reich, C., Sharma,
S., Weisbaum, J., Wilson, B., & Olsen, G. (2008). Critical evaluation of
two primers commonly used for amplification of bacterial 16s rRNA genes. 74(8),
2461-2470.
Janda, J.,
& Abbot, S. (2007). 16s rRNA gene sequencing for bacterial identification
in the diagnostic laboratory: Pluses, perils, and pitfalls. Journal of
Clinical Microbiology, 45(9), 2761-2764. Mao, D., Zhou, Q., Chen, C.,
& Quan, Z. (2012). Coverage evaluation of universal bacterial primers using
the metagenomic datasets. BMC Microbiology, 12(66), Retrieved
from www.biomedcentral.com/1471-2180/12/66. Marchesi,
J., Soto, T., Weightman, A., Martin, T., Fry, J., Hiom, S., & Wade, W.
(1997). Design and evaluation of useful bacterium-specific PCR primers that
amplify genes coding for bacterial 16s rRNA. Applied and Environmental
Microbiology, 64(2), 795-799.
Subscribe to:
Posts (Atom)










.jpg)


.jpg)




.png)


.png)